CÁC KỸ THUẬT PCR VÀ ỨNG DỤNG


KỸ THUẬT RFLP

 (Restriction Fragment Length Polymorphisms)

 I. Giới thiệu

 Kỹ thuật RFLP là kỹ thuật nghiên cứu tính đa hình chiều dài của các phân đoạn DNA dựa trên điểm cắt các enzim giới hạn (Restriction Enzyme, RE). Khi ủ DNA với enzim giới hạn ở dung dịch đệm thích hợp ở pH, nhiệt độ thích hợp sẽ  sẽ tạo ra những phân đoạn DNA với kích thước khác nhau, từ đó lập nên các bản đồ gen. Kỹ thuật này được sử dụng phổ biến từ thập niên 80 đến nay.

II. Nguyên tắc chung

Nguyên tắc của kỹ thuật này dựa trên độ đặc hiệu của các enzim cắt giới hạn (restriction enzim-RE) đối với vị trí nhận biết của chúng trên DNA bộ gen. Sự khác biệt vị trí cắt giữa hai cá thể sẽ tạo ra những phân đoạn cắt khác nhau.

III. Các enzim giới hạn (RE)

1. Giới thiệu

Enzim giới hạn được Werner Arber tìm thấy ở vi khuẩn vào năm 1962. Ông cho rằng các RE có khả năng rất đặc biệt đó là khả năng nhận biết DNA chủ và DNA lạ. Enzim này hạn chế sự nhân lên của DNA lạ khi chúng xâm nhập vào tế bào vi khuẩn bằng cách cắt chúng ra thành từng đoạn một cách đặc hiệu, vì thế ông gọi là restriction có nghĩa là hạn chế. Với phát minh này ông cùng các cộng sự (Daniel Nathans và Hamilton O. Smith) đã giành giải thưởng Nobel vào năm 1978.

Các RE hợp thành hệ thống bảo vệ ở tế bào sơ hạch (procaryote), một câu hỏi đặt ra là vì sao các RE chỉ cắt DNA của các phage mà không cắt DNA của tế bào vi khuẩn? Câu trả lời là nhờ Methylase đây là enzim giúp vi khuẩn có khả năng này, chính enzim này chịu trách nhiệm gắn nhóm metyl (CH3) vào các nucleotides ở vị trí cắt của các RE trên DNA của vi khuẩn vì thế bảo vệ DNA của vi khuẩn khỏi sự phân cắt của RE. Tuy vậy đôi lúc methylase lại gắn nhằm cả nhóm metyl vào chính DNA của phage, điều này giải thích vì sao đối với các dòng vi khuẩn kháng phage vẫn có các tế bào bị phân hủy.

Enzim cắt giới hạn đầu tiên được phân lập vào năm 1968, cho đến nay có khoảng 3.400 RE được khám phá. Trong số này có khoảng 540 RE đã được thương mại hóa.

 

2. Tên gọi của enzim cắt giới hạn

Chữ đầu viết hoa là chữ đầu tên vi khuẩn từ đó RE được ly trích.

Hai chữ kế không viết hoa tương đương với tên loài của vi khuẩn. Cả 3 chữ nầy đều viết in nghiêng. Kế đến là chữ số la mã chỉ thứ tự RE được phát hiện trong trường hợp nhiều RE được tìm thấy trong cùng một vi khuẩn.

Đôi khi còn có thêm chữ viết hoa (viết thẳng) để chỉ chủng vi khuẩn sử dụng

VD : Escherichia                  coli                Ry13

            chi                               loài                 chủng

EcoRI: là enzym đầu tiên tìm thấy trên vi khuẩn E. coli

EcoRV: enzym thứ 5 tìm thấy trên vi khuẩn E.coli

 

3. Các loại enzim cắt giới hạn

Loại I: khi enzym nhận biết trình tự nó sẽ di chuyển trên phân tử DNA cách đó 1000-5000 nu và giải phóng độ vài chục nu.

Loại II: enzym nhận biết trình tự và cắt ngay vị trí đó.

Loại III: enzym nhận biết trình tự và cắt DNA ở vị trí cách đó 20 nu.

 III. Quy trình thực hiện RFLP bao gồm các bước:

+       Tách chiết và tinh sạch DNA

+       Cắt các mẫu DNA cần phân tích bởi RE

+       Phân tách DNA trên gel agarose

+       Southern Blotting

Chuyển DNA sang màng nylon

Chọn đoạn dò (probes), đánh dấu đoạn dò

Lai ghép gen (Hybridization)

Lập bản đồ gen (phân tích đa hình)

 1.      Trích DNA

  1. a.                  Nguyên tắc: Thành tế bào bị phá vỡ bằng biện pháp cơ học và các chất tẩy mạnh. DNA được giải phóng và làm sạch tạp chất Rnase. DNA được kết tủa trong Ethanol 100% và thu lại nhờ ly tâm.
  2. b.                  Quy trình: Thực hiện theo qui trình được mô tả bởi Rogers và Bendich (1988) (qui trình CTAB) gồm các bước sau:                                                    

- Lấy lá của đối tượng cần nghiên cứu.

- Khử trùng bề mặt lá bằng cồn 70%, sau đó dùng kéo và kẹp (đã được khử trùng) cắt lá thành từng mảnh nhỏ rồi cho riêng vào các tuýp (mỗi mẫu riêng một tuýp khoảng 0,1g).

- Ngâm các tuýp và dụng cụ nghiền mẫu vào nitơ lỏng trong 10 phút.

- Cho mẫu vào máy nghiền, có tần số 27lần/giây, lập lại khoảng 3 lần.

- Cho thêm 1.000µl Extraction buffer (10ml EB +7µl β-Mercaptoethanol).

- Cho thêm 50µl SDS 10%.

- Ủ trong nước 65oC trong 30 phút. Sau 5 phút trở mặt mẫu một lần.

- Ly tâm 13.000 rpm trong 10 phút.

- Lấy 800µl dịch trong ở trên cho vào tuýp mới (bỏ phần cặn)

- Cho 800µl Isopropanol vào mỗi tuýp, lắc đều.

- Ủ mẫu ở  -20oC trong 2 giờ.

- Ly tâm 13.000rpm trong 10 phút, bỏ nước, lấy cặn.

- Cho thêm 400µl TE 0,1 vào, thêm 10µl RNase, ủ 20 phút ở 37oC.

- Cho 400µl CTAB vào, ủ 15 phút ở 65oC.

- Cho 800µl Chloroform/Isoamylalcohol, đảo nhẹ

(12ml Chloroform: 0,5ml Isoamylalcohol)

- Ly tâm 13.000rpm trong 5 phút.

- Lấy 700µl phần trong chuyển sang tuýp mới.

- Cho 1,4ml Ethanol 96% làm lạnh vào, lắc nhẹ, để 15 phút ở nhiệt độ phòng.

- Ly tâm 13.000rpm trong 10 phút, bỏ nước, lấy cặn.

- Cho 700µl Ethanol 70% làm lạnh vào, lắc nhẹ.

- Ly tâm 13.000rpm trong 10 phút, bỏ nước, lấy cặn.

- Lặp lại lần nữa với Ethanol 70% làm lạnh, thấm miệng tuýp trên giấy.

- Sấy chân không ở 45oC trong 10 phút.

- Cho 200µl TE 0,1 vào, trữ mẫu ở -20oC.

 

c. Xác định nồng độ DNA bằng phương pháp đo quang  phổ

Nguyên tắc:

 - Dựa vào sự hấp thụ mạnh ánh sáng tử ngoại ở bước sóng 260 nm và 280 nm của các bazơ purin và pyrimidin.

- Đơn vị OD260 nm tương ứng nồng độ 50mg/ml cho một dung dịch DNA sợi đôi. Do đó nồng độ DNA trong mẫu được tính theo công thức sau:
[DNA] (mg/ml) = OD260nm x 50 x Độ pha loãng
- Để kiểm tra độ tinh sạch của dung dịch có thể đo thêm giá trị OD 280nm.
- Dung dịch axit nucleic được xem là sạch (không lẫn protein) khi tỷ số : OD260nm/OD280nm nằm trong không 1.8 – 2.

 

2. Dùng enzim giới hạn cắt DNA

 Một số quy tắc khi thực hiện phản ứng cắt bằng RE

Nồng độ NaCl của dung dịch đệm, nếu phải sử dụng nhiều RE có nồng độ NaCl của dung dịch đệm khác nhau thì nên cắt với RE có nồng độ NaCl thấp trước rồi đến RE cần NaCl nồng độ cao hơn.

RE được bảo quản trong dung dịch đệm có 50% glycerol ở -200C, nên thêm vào phản ứng sau cùng, thời gian để bên ngoài càng ngắn càng tốt.

Thể tích phản ứng càng nhỏ càng có hiệu quả vì RE và DNA tiếp xúc với nhau càng tốt tuy nhiên phải bảo đảm thể tích RE không quá 1/10 thể tích phản ứng vì glycerol nhiều sẽ gây ức chế hoạt động của RE.

 

3. Southern Blot

a. Chuyển DNA sang màng nylon

- Cắt DNA thành các đoạn nhỏ bằng enzim giới hạn thích hợp.

- Ðiện di sản phẩm cắt trên gel Agarose để tách các đoạn DNA theo kích thước.

- Làm biến tính DNA, khi DNA còn trên gel bằng dung dịch kiềm.

Ví dụ: có thể nhúng DNA vào trong dung dịch NaOH 0.5M : NaCl 1.5M, DNA sợi kép sẽ được tách thành DNA sợi đơn.

- Chỉ DNA sợi đơn mới có thể chuyển lên màng lai.Chuyển DNA đã biến tính lên màng lai.  

- Màng lai được sử dụng là màng nitrocellulose. Người ta cũng có thể sử dụng màng nylon. Màng nitrocellulose điển hình có khả năng tiếp nhận 100µg DNA/cm2, trong khi màng nylon có khả năng tiếp nhận 500µg DNA/cm2. Mặt khác màng nylon có khả năng giữ DNA chắc hơn và ít đứt gãy hơn. Việc chuyển DNA thường được tiến hành bằng hoạt tính mao dẫn trong khoảng vài giờ hoặc có thể dùng một thiết bị thấm chân không. Nếu dùng thiết bị thấm chân không thì sẽ nhanh hơn, chỉ mất khoảng một giờ. Trong quá trình chuyển, vị trí các đoạn DNA vẫn được giữ nguyên không thay đổi.

 

 

 Vaät naëng

Taám kính

 giaáy thaám

Maøng lai

Gel

Giaáy thaám daày

Dung dòch chuyeån

Acid nucleic được chuyển lên màng lai nhờ lực mao dẫn.

 

b. Cách chọn đoạn dò (probes)

Probe (đoạn dò) là một sợi nucleic acid (hoặc ribonucleic acid) có trình tự xác định và được đánh dấu bằng các phương pháp khác nhau dùng để nhận diện các đoạn nucleic acid khác có trình tự bổ sung với nó. Quá trình này dựa trên nguyên tắc biến tínhhồi tính của phân tử DNA, được gọi là lai phân tử DNA. Các phương pháp cổ điển có sử dụng probe là Northern Blot (nhận diện bản RNA phiên mã), Southern Blot (nhận diện các phiên bản của gene). Công nghệ DNA chipcDNA micro-arrays được thiết kế dựa trên nguyên tắc sử dụng các probe của các phương pháp lai phân tử nhưng cho phép nghiên cứu đồng loạt hàng nghìn gene khác nhau.

+       Probe có thể được thiết kế dựa trên những trình tự có sẵn tuỳ vào mục đích của từng thí nghiệm và các thông tin đã có.

+       Dựa trên trình tự genome của đối tượng nghiên cứu để nhận diện các bản sao của gen hoặc sản phẩm RNA của gen.

+       Dựa trên trình tự genome của các sinh vật có quan hệ gần gũi với đối tượng nghiên cứu nhằm tìm kiếm gen chức năng được bảo tồn qua quá trình tiến hoá.

+       Dựa trên trình tự amino acid của protein là sản phẩm của gene. Từ đó tìm kiếm trình tự trọn vẹn của gene mã hoá cho protein đó trên genome.

Trong quá trình thiết kế đoạn dò cần bảo đảm các yếu tố sau: 1) tính đặc trưng của probe, 2) không có hiện tượng lai chéo giữa các probe hoặc tạo cấu trúc không gian nội tại trong probe, 3) giá trị nhiệt độ biến tính (Tm) phải phù hợp khi thực hiện phép lai nhiều probe một lúc.

 

c. Cách ghi nhãn đoạn dò cho phương pháp lai Southern

  • Cách ghi phóng xạ

Thường dùng: 3 H,  32P,  33P,  S 35

Mẫu dò được đánh dấu trong một phản ứng sao chép DNA nhờ một dNTP mang chất đòng vị phóng xạ

Xem kết quả: phóng xạ tự ghi (autoradiograph)

 

  • Cách ghi huỳnh quang

Mẫu dò được đánh dấu trong một phản ứng sao chép DNA nhờ một dNTP mang chất phát huỳnh quang

Xem kết quả: máy đo huỳnh quang

 

Ưu điểm và khuyết điểm của kỹ thuật RFLP

- RFLP có ưu điểm là marker đồng trội cho phép phân biệt được cá thể đồng hợp và dị hợp. Do kích thước DNA khảo sát trong RFLP lớn vì vậy số lượng dấu phân tử (marker) tạo ra nhiều đủ đáp ứng nhu cầu nghiên cứu.

- Tuy nhiên do qui trình thực hiện phức tạp, nguy hiểm đối với sức khoẻ người nghiên cứu (sử dụng phóng xạ đánh dấu), và DNA yêu cầu có chất lượng cao đã làm hạn chế việc sử dụng kỹ thuật này. Hơn nữa hiện nay, ở nước ta nhà nước chưa cho phép nhập các chất phóng xạ.

- Cùng với sự phát triển kỹ thuật PCR, kỹ thuật RFLP trở nên đơn giản hơn. Một cặp mồi oligonucleotide có thể dùng khuếch đại một vùng DNA cần khảo sát, sau đó đoạn DNA được khuếch đại được cắt bằng các RE, điện di và phân tích trên gel nhuộm ethidium bromide hoặc bạc. PCR-RFLP bỏ qua bước lai nên giá thành rẻ hơn và ít nguy hiểm hơn phương pháp RFLP.

 

IV. Ứng dụng:

- Trần Thanh Mến đã sử dụng kỹ thụât PCR-RFLP để nghiên cứu đa dạng sinh học các giống bưởi (Citrus maxima (Burm.) Merr.) ở Việt Nam. Thực hiện phản ứng PCR với 2 cặp mồi ITS 1 và ITS 2; ITS 1 và ITS 4. Các sản phẩm PCR của từng cặp mồi được cắt bằng 6 enzim giới hạn SmaI, EcoRI, HindIII, PstI, BamHI, KpnI. Dựa vào kết quả thu được ta xác định được mối tương quan di truyền của các giống cây này.

      – Bác sĩ Lê Nhật Minh, Phan Lê Thanh Hương và Lê Thị Kim Tuyến đã sử dụng            kỹ thuật PCR-RFLP để xác định một số vi khuẩn là căn nguyên chính gây viêm màng não ở trẻ em. Kỹ thuật PCR sử dụng một cặp mồi chung cho phép nhân lên một đoạn DNA có kích thước 996bp trên gen mã hóa cho yếu tố 16S ribosom của 11 loài vi khuẩn, sau đó sản phẩm PCR được cắt bằng enzim Hae III kết quả đã phân biệt được 11 loài vi khuẩn chuẩn khác nhau và xác định chính xác 9 loài vi khuẩn là căn nguyên chính gây viêm màng não ở trẻ em.(Trích Hội nghị Khoa học – 2006 – Viện Pasteur TP.HCM)

KỸ THUẬT PCR (Polymerase Chain Reaction)

 

I. Giới thiệu

PCR là chữ viết tắt của cụm từ Polymerase Chain Reaction (Phản ứng chuỗi trùng hợp – phản ứng khuếch đại gen). Đây là kỹ thuật của sinh học phân tử cho phép nhân bản một đoạn DNA mong muốn từ hệ gen DNA của cơ thể sinh vật thành nhiều bản sao, kỹ thuật này được nhà khoa học người Mỹ – Kary Mullis và cộng sự phát minh năm 1985 tại công ty Cetus; mặc dù nguyên tắc này đã được mô tả chi tiết trước đó một thập niên bởi Khorana và ctv., (Kleppe và ctv., 1971; Panet và ctv., 1974), và được giới thiệu lần đầu tiên tại Hội thảo lần thứ 51 ở Cold Spring Harbor vào năm 1986 và ông đã nhận được giải thưởng Nobel Hoá sinh học vào năm 1993. Kể từ đó đã tạo nên một tác động to lớn đối với các nghiên cứu sinh học trên toàn thế giới.

 

II. Nguyên lý

Nguyên lý nhân gen trong tế bào:

DNA là vật chất di truyền của cơ thể sống quy định lên đặc tính của cơ thể (ngoại trừ một số loại virus có vật chất di truyền là RNA). Đối với những sinh vật có cấu trúc tế bào nhân chuẩn, các phân tử DNA tồn tại dưới dạng kết hợp với protein thành các nhiễm sắc thể trong nhân tế bào. Ngoài ra, tại các cơ quan tử như ty thể và lạp thể (ở thực vật) cũng chứa DNA ở dạng plasmid.

Các phân tử DNA ở những tế bào hoạt động bình thường chỉ được nhân lên trong quá trình phân bào nguyên nhiễm. Để thực hiện được quá trình này, đòi hỏi phải có mặt enzim DNA polymerase, sự tham gia của các đoạn mồi có trình tự bổ sung gắn vào vào sợi DNA khuôn và các dNTPs làm nguồn cung cấp nucleotit. Trong quá trình phân bào nguyên nhiễm, các sợi DNA kép được mở xuắn tách thành các sợi DNA sợi đơn. Dưới tác dụng của enzim DNA polymerase, quá trình tổng hợp DNA được xảy ra theo cách gắn lần lượt các nucleotit vào đoạn mồi để kéo dài chuỗi theo nguyên tắc bổ sung với DNA khuôn. 

Nguyên lý của kỹ thuật PCR

Kỹ thuật tổng hợp DNA ngoài cơ thể cũng tuân thủ những nguyên tắc cơ bản của sao chép DNA trong cơ thể nhưng có sự khác biệt:

  + Dùng nhiệt độ cao tháo xoắn thay cho enzim helicase.

  + Kết hợp với enzim DNA polymerase chịu nhiệt để tổng hợp DNA mới trong môi trường thích hợp.

  + Hệ thống điều nhiệt thích hợp cùng với các đoạn mồi được thiết kế chuyên biệt, chủ động.

Phương pháp PCR cho phép tổng hợp rất nhanh và chính xác từng đoạn DNA riêng biệt. Ðây thực sự là phương pháp hiện đại và thuận tiện cho việc xác định sự có mặt của một gen nào đó trong tế bào với độ chính xác cao.

Phương pháp này dựa trên sự khám phá hoạt tính sinh học ở nhiệt độ cao của DNA polymerase được tìm thấy trong các sinh vật ưa nhiệt (vi khuẩn sống trong các suối nước nóng). Phần lớn các DNA polymerase chỉ làm việc ở nhiệt độ thấp. Nhưng ở nhiệt độ thấp, DNA xoắn chặt vì vậy DNA polymerase không có nhiều khả năng làm biến tính phần lớn các phần của phân tử. Nhưng các polymerase chịu nhiệt này hoạt động ở nhiệt độ rất cao, có thể lên đến 1000C. Ở nhiệt độ này DNA sẽ bị biến tính (DNA dạng xoắn sẽ duỗi ra và ở dạng thẳng).

 Một phản ứng PCR là một chuỗi nhiều chu kỳ nối tiếp nhau, mỗi chu kỳ gồm ba giai đoạn: giai đoạn biến tính, giai đoạn bắt cặp, giai đoạn kéo dài.

 III. Máy PCR

Trước đây, khi chưa có máy chu kỳ nhiệt, để thực hiện được phản ứng PCR các nhà khoa học gặp 2 trở ngại lớn:

+       Lúc đầu enzim Klenow polymerase được sử dụng bị phân hủy ở 950C nên phải thêm enzim vào ống nghiệm sau mỗi chu kỳ ở giai đoạn phân tách chuỗi DNA.

+       Để thay đổi chu kỳ nhiệt các nhà khoa học phải sử dụng 3 water baths ở 3 nhiệt độ khác nhau. Khi đếm và thay đổi 30 đến 35 chu kỳ nhiệt khá phiền phức, dễ gây sai sót.

 Việc tìm ra enzim Taq polymerase và máy PCR tự động thay đổi các chu kỳ nhiệt đã làm cho kỹ thuật này phát triển nhanh và được ứng dụng rộng rãi trong nhiều lĩnh vực nghiên cứu (McPherson và ctv., 1992).

             Một cách tổng quát, máy PCR gồm các bộ phận chính như sau :

+       Một bàn phím đơn giản để lập các chương trình chu kỳ nhiệt và ra các mệnh lệnh để máy thực hiện.

+       Một bộ vi xử lý để ghi nhớ các chương trình đã nạp vào máy, thực hiện các mệnh lệnh cũng như ghi nhận cách thay đổi nhiệt độ buồng ủ PCR trong các chu kỳ nhiệt để điều chỉnh cho đúng với chương trình đang được thực hiện.

Buồng ủ PCR là nơi mà các chu kỳ nhiệt được thực hiện qua sự điều khiển của bộ vi xử lý. Trong các chu kỳ nhiệt, nhiệt độ trong buồng ủ PCR có thể đưa lên cao hay hạ xuống thấp trong một thời gian rất ngắn. Ðể làm thay đổi được nhiệt độ trong buồng ủ PCR, có hai phương pháp :

(1) Liên tục thổi lên buồng ủ những luồng khí nóng sinh ra từ một đèn phát nhiệt, hay luồng khí lạnh sinh ra từ một hệ thống của máy làm lạnh. Với phương pháp này, máy luân nhiệt hãy còn tương đối cồng kềnh, khá đắt tiền và khi máy hoạt động âm thanh cũng khá ồn ào.

(2) Phương pháp thứ hai hoạt động dựa theo hiệu quả Peltier ngược. Hiệu quả Peltier là nguyên tắc của các máy đo nhiệt độ điện tử : Khi áp hai mãnh kim loại vào nhau và khi có sự cách biệt nhiệt độ giữa hai mãnh kim loại thì sẽ sinh ra một dòng điện và chính sự lưu thông của dòng điện này khi đo lường sẽ phản ánh sự cách biệt nhiệt độ giữa hai mãnh kim loại. Hiệu quả Peltier ngược lại vận hành theo kiểu ngược lại, nghĩa là khi tạo ra một dòng điện giữa hai mãnh kim loại thì sẽ tạo ra được một sự cách biệt nhiệt độ giữa hai mãnh : bên này nóng, bên kia lạnh. Khi thay đổi chiều dòng điện thì nhiệt độ của hai mãnh cũng thay đổi ngược lại: bên này lạnh, bên kia nóng. Các máy chu kỳ nhiệt hiện nay đều được chế tạo dựa theo phương pháp thứ hai này, nhờ vậy mà máy trở nên rất gọn nhẹ, giá thành rẽ hơn gấp nhiều lần so với trước đây.

 IV. Chuẩn bị mẫu DNA

Mẫu DNA của đối tượng cần nghiên cứu được ly trích và tinh sạch, sau đó trữ mẫu  ở – 200C.

 

V. Thiết kế mồi

- Mồi là những đoạn oligonucleotide (18-24 base) bổ sung với trình tự trên DNA, gồm có mồi xuôi và mồi ngược

  • Mồi xuôi (sense primer hoặc Forward) bắt cặp với mạch khuôn của DNA và sẽ kéo dài theo chiều phiên mã.
  • Mồi ngược (anti sense primer hoặc Reverse) bắt cặp với mạch mã của DNA và sẽ kéo dài ngược theo chiều phiên mã.

 

+       Trình tự của mồi được thiết kế sao cho không có sự bắt cặp giữa mồi xuôi và mồi ngược, kể cả cấu trúc kẹp tóc

+       Nhiệt độ gắn mồi của mồi xuôi và mồi ngược không được chênh lệch quá xa (Không nên quá nhiều G hoặc C nối tiếp nhau, thường tỷ lệ G, C nằm trong khoảng  30%< G+C<70%

+       Mồi phải bảo đảm đủ dài để bắt cặp chính xác.

+       Các mồi được chọn phải đặc trưng cho trình tự DNA cần khuyếch đại không trùng với các trình tự lặp lại trên DNA,  một mồi chỉ bám vào một vị trí nhất định trên gen.

+       Trình tự nằm giữa mồi xuôi và mồi ngược không quá lớn (<3000 nu

tốt nhất là dưới 1000 nu)

 HÌNH: Sự hình thành nút cài tóc do mồi chứa trình tự đối xứng bậc hai

  ách tính nhiệt độ bắt mồi:

 - Đối với mồi ≤ 20 nucleotide thì nhiệt độ gắn mồi được tính như sau:

                                    Tm = [2(A+T) + 4 (G+C)]

* Ví dụ, đoạn mồi CAGCAAATATCTGTCCTTAC thì  nhiệt độ gắn mồi:

                                Tm = [2(6+6) + 4(2+6)] = 560C

            – Đối với mồi >20 nucleotide thì nhiệt độ gắn mồi được tính theo công thức:

Tm = 22 + 1.46[ 2(G + C) + (A + T)]0C

VI. Điều kiện phản ứng PCR

Ðể thử nghiệm PCR có thể chạy được, cần phải có đầy đủ các thành phần sau đây:

1. Nước

Nước sử dụng cho phản ứng PCR phải thật tinh khiết, không chứa ion nào, không chứa DNAase, RNAase, enzim cắt giới hạn…Nói cách khác là không chứa bất kỳ một thành phần nào khác.

 

2. Dung dịch đệm cho phản ứng PCR:

Dung dịch đệm cho PCR là một trong những yếu tố quan trọng ảnh hưởng đến chất  lượng phản ứng PCR.

Thành phần dung dịch đệm của phản ứng PCR thường phụ thuộc vào loại enzim DNA polymerase sử dụng trong PCR, thường chứa muối đệm Tris HCl 10 mM, KCl50mM và MgCl2 1.5mM. Ngoài ra dung dịch đệm PCR còn có thể chứa 0.001% BSA hay Gelatine và trong một số phản ứng PCR còn có thể  thêm tween hay formamide nữa. Trong các thành phần trên, có lẽ ảnh hưởng lên thử nghiệm PCR nhiều nhất là nồng độ MgCl2, vì vậy để có được một thử nghiệm PCR có độ nhạy cao, phản ứng rõ nét, người ta phải tối ưu hóa phản ứng bằng cách thăm dò một nồng độ MgCl2 thích hợp nhất.

Nồng độ MgCl2 có thể dao động từ 0.5-5 mM. Chính ion Mg2+ gắn liên kết dNTP với DNA polymerase, tăng khả năng bám nối của mồi. Nồng độ MgCl2 cao sẽ tạo nhiều sản phẩm không đặc hiệu, nồng độ MgCl2 quá thấp sẽ không tạo sản phẩm PCR.

 

3. dNTP (deoxy nucleoside triphosphate), tức là đơn vị để có thể tổng hợp được các bản sao của DNA đích. dNTP có cấu tạo gồm một đường deoxyribose có gắn một base, có thể là Adenine (dATP) hay Thymine (dTTP) hay Cytosine (dCTP) hay Guanine (dGTP) , ở carbone số 1 (C1). Ba phân tử phosphate (triphosphate) được gắn tại carbone số 5 (C5) của phân tử deoxyribose này và đây chính là nơi mà dNTP gắn vào đầu 3’ của chuỗi bổ sung trên chuỗi DNA đích. Năng lượng để cho phản ứng này xảy ra được lấy từ các nối phosphate giàu năng lượng của triphosphate trên dNTP. Ðó cũng chính là lý do tại sao phải là dNTP chứng không phải là dNDP (diphosphate) hay dNMP(monophosphate).

 Mồi (primer)

Mồi là những đoạn DNA sợi đơn ngắn và cần thiết cho việc xúc tiến phản ứng dây chuyền tổng hợp DNA. Chúng nhận ra phần DNA cần được nhân lên, bắt cặp bổ sung với một đầu của DNA mẫu và tạo ra vị trí bắt đầu tái bản. Các mồi này có chiều ngược nhau, bao gồm một mồi xuôi (forward primer) và một mồi ngược (reverse primer).

Mồi là yếu tố quan trọng nhất của phản ứng PCR, quyết định tính đặc hiệu

của phản ứng

Trong thử nghiệm PCR, đoạn mồi có hai vai trò chính : (1) Quyết định nên tính đặc hiệu của thử nghiệm, vì nếu đoạn mồi được chọn càng đặc hiệu cho chuỗi đích, nghĩa là chỉ có thể bắt cặp trên chuỗi đích mà không thể bắt cặp được trên các chuỗi DNA khác ngoài chuỗi đích, thì sản phẩm PCR càng đặc hiệu và thử nghiệm PCR càng đặc hiệu. (2) Khởi động men polymerase vì men polymerase chỉ có thể bắt đầu tổng hợp sợi bổ sung cho chuỗi DNA đích một khi nó nhận dạng được đầu 3’ (là đầu mà nó xúc tác cho một dNTP được gắn vào) đang ở tình trạng sợi đôi

 

5. Enzim DNA polymerase (Taq)

             Là enzim xúc tác cho quá trình lắp ráp các nucleotide  A, T, G, C vào mạch DNA mới tổng hợp, phải là men polymerase chịu được nhiệt độ cao.

Vào thập niên 1960, nhà Vi sinh vật học Thomas Brock đã đến Công viên Quốc gia Yellowstone (Bang Wyoming, Mỹ) để nghiên cứu các vi sinh vật ưa nhiệt sống trong suối nước nóng 80-900C. Ông đã phát hiện một loài vi khuẩn phát triển mạnh ở nhiệt độ cao, có tên là Thermus aquaticus. Hai mươi năm sau, các nhà khoa học của tập đoàn Cetus (Tập đoàn Công nghệ Sinh học California) đã nhận thấy rằng DNA polymerase từ Thermus aquaticus (Taq-polymerase) có khả năng giải quyết vấn đề của enzim biến tính sau mỗi chu kỳ. DNA polymerase chịu nhiệt sử dụng cho phản ứng PCR lần đầu tiên được bán trên thị trường là Taq-polymerase. Từ đó đến nay, một số vi sinh vật chịu nhiệt khác đã được khám phá và người ta đã tách chiết thêm được các DNA polymerase chịu nhiệt để sử dụng cho phản ứng PCR như Vent- polymerase (Tli-polymerase), Pfu- polymerase, rTth

 

6. DNA mẫu (DNA template) là mẫu DNA mà chúng ta sẽ khuếch đại. Có thể là DNA kép, đơn, hoặc RNA được tách chiết từ các đối tượng nghiên cứu. DNA khuôn có độ nguyên vẹn cao tránh lẫn tạp chất.

 

 

 

VII. Chu kỳ nhiệt

Có 3 giai đoạn chính trong phản ứng PCR và chúng được lặp đi lặp lại nhiều lần (chu kỳ) (thường từ 25 đến 75 chu kỳ).

 

* Giai đoạn biến tính (denaturation): tách chuỗi DNA từ sợi đôi tách thành 2 sợi đơn. Nhiệt độ tăng lên 94-96°C để tách hai sợi DNA ra. Bước này gọi là biến tính, nhiệt độ tăng lên sẽ phá vỡ cầu nối hydrogen của chuỗi DNA. Trước chu kỳ 1, DNA thường được biến tính đến thời gian mở chuỗi để đảm bảo mẫu DNA và mồi được phân tách hoàn toàn và chỉ còn dạng sợi đơn. Thời gian ở giai đoạn này khoảng : 1-2 phút.

 

* Giai đoạn bắt cặp (annealing): gắn cặp mồi đặc trưng theo nguyên tắc bổ sung. Sau khi 2 sợi DNA tách ra, nhiệt độ được hạ xuống để mồi có thể gắn vào sợi DNA đơn. Nhiệt độ giai đoạn này phụ thuộc vào đoạn mồi và thường thấp hơn nhiệt độ biến tính khoảng 45-60°C. Sử dụng sai nhiệt độ trong giai đoạn này dẫn đến việc đoạn mồi không gắn hoàn toàn vào DNA mẫu, hay gắn một cách tùy tiện. Thời gian bắt cặp từ 1-2phút.

 

* Giai đoạn kéo dài (extension): tổng hợp chuỗi DNA mới giống chuỗi DNA gốc. DNA polymerase gắn tiếp vào sợi trống. Nó bắt đầu bám vào và hoạt động dọc theo sợi DNA. Nhiệt độ kéo dài phụ thuộc DNA-polymerase. Thời gian của bước này phụ thuộc vào cả DNA-polymerase và chiều dài mảnh DNA cần khuếch đại. Như một quy tắc 1000bp/ 1 phút .

Các đoạn DNA mới được hình thành lại được sử làm khuôn để tổng hợp cho các chu kỳ tiếp theo.

Như vậy số lượng bản sao sẽ tăng gấp 2 sau mỗi chu kỳ và sau n chu kỳ, tính theo lý thuyết số lượng bản sao là 2n

VI. Các ứng dụng

Kỹ thuật PCR được ứng dụng rộng rãi trong nhiều lĩnh vực khác nhau, từ nghiên cứu khoa học đến sản xuất và đời sống xã hội. Những ứng dụng chính của kỹ thuật PCR là:

- Xác định các đoạn trình tự cần nghiên cứu

- Phát hiện đột biến

- Nghiên cứu quá trình tiến hoá phân tử

- Phục hồi các gen đã tồn tại hàng triệu năm

- Chọn giống vật nuôi, cây trồng

- Lựa chọn các cặp cha mẹ thuần chủng trong thời gian ngắn

- Xác định các loài mới, các loài đặc hữu bằng phưng pháp di truyền phân tử
Y học – Khoa học hình sự.

- Chuẩn đoán chính xác các bệnh nhiễm trùng từ vi khuẩn, nấm, virus

- Chuẩn đoán sớm các bệnh gây ra do ung thư, các bệnh di truyền

- Xác định huyết thống, truy tìm dấu vết tội phạm

- Là kỹ thuật nền cho các kỹ thuật khác như: RAPD, SSR…

 

+       Nguyễn Thị Thu Lan, Nguyễn Hoàng Chương, Hồ Huỳnh Thuỳ Dương, Huỳnh Thị Lệ Duyên, Phan Kim Ngọc. 2003. Xác định giới tính ở heo bằng kỹ thuật PCR. Tạp chí di truyền & ứng dụng ,Số 4.

+       Tang và ctv (2000) đã dùng kỹ thuật PCR competitive để định lượng WSSV (White Spot Syndrome Virus) nhiễm trong Penaeus monodon Fabricius để phân loại giai đoạn nhiễm WSSV thành mức độ nhẹ, trung bình và nặng, từ đó có cách xử lý thích hợp làm giảm thiệt hại trong nghề nuôi tôm (Tang, K. F. J., Lightner D. V.,2000. Quantification of white spot syndrome virus DNA throught a competitive polymerase chain reaction. Aquaculture, 189:11-21)

+       Phát hiện nhanh Salmonella spp. trong thực phẩm (Phẩm Minh Thu, Phan Thu Dòng, Trương Xuân Liên và cộng sự. Viện Pasteur TP.HCM)

+       Áp dụng kỹ thuật PCR sản xuất Bộ KIT chuẩn đoán bệnh đốm trắng trên tôm, bệnh vàng lá gân xanh. Viện NC&PT Công nghệ Sinh học- Đại học Cần Thơ.

 CÁC KỸ THUẬT IN DẤU DNA (DNA FINGERPRINTING)

I. Kỹ thuật RAPD (Random Amplified Polymorphic DNA)

 

1. Giới thiệu

Là phương pháp phân tích đa dạng DNA khuyếch đại ngẫu nhiên, kỹ thuật này được phát hiện vào năm 1990 (Welsh và McClelland; William và ctv.). Dùng nghiên cứu sự khác biệt di truyền của những loài khác nhau. Mồi được sử dụng trong kỹ thuật RAPD là những sợi oligonucleotide gồm 10-mer có trình tự sắp xếp ngẫu nhiên. Các sản phẩm RAPD được phân tích bằng cách điện di trên gel agarose. Hệ gen của hai loài khác nhau sẽ cho những đoạn băng trên gel khác nhau, từ đó có thể so sánh sự đa dạng sinh học của các giống cây.

2. Nguyên tắc

Kỹ thuật RAPD dựa trên kỹ thuật PCR, bằng cách sử dụng những primer ngắn (khoảng 10 nucleotide) có trình tự biết trước, bắt cặp và nhân bản ngẫu nhiên những đoạn DNA có trình tự bổ sung với trình tự của các primer. Các đoạn mồi oligonucleotide nếu bắt cặp ngẫu nhiên với cả hai mạch đối diện của mạch khuôn DNA trong khoảng cách có thể khuếch đại được (dưới 3000bp) sẽ cho ra những đoạn DNA có kích thước khác nhau sau khi khuếch đại. Sự có mặt của các sản phẩm DNA khác nhau chứng tỏ đã có một sự tương đồng hoàn toàn hay một phần giữa DNA bộ gen và mồi. Các mồi dùng trong RAPD thường ngắn vì vậy dễ dàng tìm được các đoạn tương đồng trên mạch đơn DNA bộ gen. Do đó tính đa dạng thu được nhờ RAPD là đáng tin cậy, vì khi có sự thay đổi một base nitơ nào đó thì nó sẽ ngăn cản việc tiếp hợp giữa mồi và DNA mạch khuôn. Sự mất đoạn nhiễm sắc thể hoặc sự thêm bớt điểm gắn mồi cũng như sự xen vào của một gen nào đó sẽ làm thay đổi kích thước đoạn DNA được khuếch

Dùng nhiều primer khác nhau sẽ khuếch đại nhiều đoạn gen với kích thước khác nhau, kết quả này được thể hiện trên gel với nhiều băng (band) ở những vị trí khác nhau, các băng đa hình được ghi nhận và từ đó có thể vẽ được bản đồ trên một quần thể đang phân ly. 

Sinh vật cùng loài sẽ có kiểu gen hoàn toàn giống nhau, sẽ khuyếch đại các đoạn DNA có kích thước giống nhau khi sử dụng bất kỳ mồi ngẫu nhiên nào để chạy PCR. Sinh vật khác nhau ít nhiều sẽ khác nhau về kiểu gen _ đa dạng về sinh học, thì với một số mồi ngẫu nhiên nào đó các đoạn DNA được khuyếch đại sẽ có kích thước khác nhau.

  • Mồi

Là đoạn ngắn oligonucleotide đơn (10 nu) được tổng hợp một cách ngẫu nhiên, có hàm lượng G+C từ 60-70%, và không có đầu tự bổ sung.

Để tìm sự khác biệt giữa các loài, người ta thường sử dụng một số lượng lớn các mồi ngẫu nhiên.

Trên thị trường hiện nay có rất nhiều mồi ngẫu nhiên được tổng hợp nhân tạo.

 

3. Qui trình thực hiện kỹ thuật RAPD

- Thiết kế mồi

- Chuẩn bị mẫu DNA: mẫu DNA được ly trích phải đủ thuần, Ít tạp chất.

- Pha mix cho phản ứng PCR với các thành phần theo thứ tự sau:

H2O tiệt trùng, Buffer, dNTP tổng số, mồi xuôi, mồi ngược, Taq polymerase, DNA mẫu.

- Cho vào máy lập chương trình chạy phù hợp

- Kiểm tra sản phẩm PCR trên gel agarose với sự có mặt của thang chuẩn

- Phân tích kết quả bằng phần mềm BioPRO.

- Xác định tính di truyền bằng các phần mềm thông dụng. Các số liệu thu được cho thấy sự gần gũi hay cách biệt di truyền của các mẫu nghiên cứu.

- Hệ số đồng dạng di truyền có thể được tính theo công thức của M. Nei & Li (1979)

Sij= 2Nij/ Ni + Nj

 

Ni: số vạch của giống i

Nj: số vạch của giống j

Nij: số vạch chung của 2 giống i và j

4.Ứng dụng

Kỹ thuật RAPD được ứng dụng đê nghiên cứu đa dạng di truyền của các giống.

Phát hiện khả năng di truyền liên quan đến 1 tính trạng: trong  chương trình cải thiện giống, nhà chọn giống thường quan tâm đến những tính trạng mà nó biểu hiện bên ngoài đó chính là kiểu hình (phynotype). các tính trạng đó có thể là tính kháng sâu bệnh, tính chống chịu phèn mặn … Nhưng nếu việc phân tích di truyền chỉ dựa trên kiểu hình thường kết quả dẽ bị sai lệch, do kiểu hình là tương tác giữa kiểu gen và môi trường. Chính vì thế, nhà chọn giống cần phải biết tính trạng đó liên kết với kiểu gen như thế nào, phương pháp RAPD cũng giúp phát hiện được điều này (Vương Đình Trị, 1998)

Thiết lập bản đồ di truyền: từ quần thể cha mẹ F1 và quần thể phân ly F2, người ta có thể đánh giá các băng hiện diện , sau đó dùng phần mềm phổ biến hiện nay là Mapmarker để thiết lập bản đồ di truyền.

Sử dụng kỹ thuật RAPD ”Nghiên cứu đa dạng sinh học của giống cây có múi ở huyện Gò Quao, tỉnh Kiên Giang”. Nhóm nghiên cứu đã sử dụng 4 mồi A02, A04, A11 và A13 trong phân tích đa dạng di truyền ; kết quả có 49 dấu phân tử được ghi nhận. Từ đó vẽ được giản đồ phả hệ của các giống cây này. Nguyễn Hữu Hiệp, Trần Nhân Dũng, Đặng Thanh Sơn và Nguyễn Văn Được. Tạp chí Khoa học 2004:1, trang 105-114.

            Phương pháp RAPD có những nhược điểm:

Sự xuất hiện các băng tính trội, điều đó không phân biệt được cá thể đồng hợp tử và cá thể dị hợp tử.

Tính lập lại không cao do primer là primer ngẫu nhiên và phụ thuộc điều kiện phản ứng PCR.

Trở ngại trong việc giải thích các băng có cùng tóc độ di chuyển.

            Những ưu điểm nổi bật của kỹ thuật RAPD:

Phương pháp phát hiện nhanh tính đa dạng di truyền

Đơn giản, không dòi hỏi kỹ thuật cao.

Tương đối rẽ tiền so với các phương pháp khác như RFLP, SSR…

Không dùng đồng vị phóng xạ.

 kỹ thuật AFLP

I. Giới thiệu

Kỹ thuật AFLP (Amplified Fragments Length Polymorphism) được hiểu là sự đa dạng của các đoạn DNA được nhân lên có định hướng sau khi bị cắt bởi 2 enzim giới hạn, sử dụng những phân đoạn DNA làm khuôn cho phản ứng khuếch đại PCR. AFLP là một trong những kỹ thuật in dấu DNA được phát triển bởi Vos và cộng sự năm 1995. Kỹ thuật này là một công cụ hữu ích để xác nhận nhiều loci của đa hình DNA mà không cần phải biết trước thông tin về trình tự DNA của chúng (Michelmore và ctv., 1998), phương pháp này có thể đưa ra nhanh chóng một ước lượng độ đa dạng di truyền trong và giữa những quần thể với nhau (Breyen và ctv., 1997; Cervera và ctv.,1996)

 

II. Nguyên tắc

Nguyên tắc của phương pháp AFLP cũng giống như RFLP, điểm khác biệt cơ bản là AFLP không cần tiến hành lai phân tử (lai Southern blot ), do vậy thực hiện nhanh hơn. Kỹ thuật AFLP gồm hai nội dung cơ bản là:

            – Cắt DNA bằng enzim giới hạn có bổ sung các adaptor đặc hiệu tạo nên các đoạn mút giống nhau, đặc trưng cho các mồi đã chọn trước. Cặp enzyme thường được dùng nhất là EcoRI – MseI. Đoạn adaptor gồm 2 phần: phần trình tự lõi và phần trình tự đặc hiệu cho vị trí cắt enzyme.

            – Khuếch đại đoạn DNA bằng kỹ thuật PCR ngắt quãng với hai loại mồi khác nhau. Mồi của phản ứng PCR được thiết kế dựa trên trình tự adaptor và chứa một trình tự chọn lọc khoảng vài nucleotide. Chỉ những phân đoạn DNA nào chứa cả trình tự adaptor và trình tự nucleotide chọn lọc mới được khuếch đại, chính trình tự chọn lọc sẽ làm giảm sự xuất hiện sản phẩm PCR và làm đơn giản quá trình phân tích.

 I. Kỹ thuật AFLP

1. Qui trình

Qui trình thực hiện AFLP gồm bốn bước:

           

Bước 1: Digestion

Dùng 2 enzim giới hạn EcoRI (ít có = 4096 bases) có trình tự nhận biết 6 base  và MseI (thường có = 256 bases) có trình tự nhận biết 4 base, cắt DNA khuôn thành những phân đoạn. Hai enzym giới hạn này được dùng để sắp xếp lại DNA nhờ kết hợp với 2 adaptor có cấu trúc làm cho dây DNA không trở lại hình dạng ban đầu

 Vị trí cắt của enzim

 

 

 

EcoRI = 5’-G AATT C-3’

              3’-C TTAA G-5’

 

 

 

MseI = 5’-T TA A-3’

            3’-A AT T-5’

 

 

Bước 2 : Ligation

Nối với EcoRI adaptor và MseI adaptor, là những oligonucleotide sợi đôi gắn vào 2 đầu phân đoạn DNA. Cấu trúc của 2 adaptor như sau :

EcoRI-adaptor

5′-CTCGTAGACTGCGTACC                                                                                                               

             CTGACGCATGGTTAA-5′

MseI-adaptor

 5′-GACGATGAGTCCTGAG

                 TACTCAGGACTCAT-5′

Bước 3 : Tiền khuếch đại

- Chạy PCR với các mồi (primer) chọn lọc, các mồi này được cấu tạo gồm 3 phần : trình tự nồng cốt (CORE) + trình tự theo enzim (ENZ) + trình tự chọn lọc (EXT) (theo định hướng của người nghiên cứu ký hiệu là NNN, có thể là TGA hoặc AAC hoặc CTG…)

Nhờ vậy, chỉ những phân đoạn có nu bổ sung được với nu chọn lọc được nhân lên. Sự khuếch đại chọn lọc như vậy làm giảm số lượng phân đoạn hàng ngàn lần. Chỉ những đoạn DNA ngắn có một đầu là primer MseI và một đầu là primer EcoRI là được khuếch đại đáng kể, các đoạn có hai đầu là EcoRI bị mất đi do số lượng ít  và hai đầu là MseI tự tạo thành vòng nhỏ DNA do cạnh tranh với primer. Sản phẩm tiền phản ứng được pha loãng và được dùng làm vật liệu để khuếch đại với đoạn mồi chọn lọc màu huỳnh quang.

 

Bước 4 : Khuếch đại

Sản phẩm PCR của bước tiền khuếch đại được dùng làm khuôn cho bước khuếch đại sau đó, sử dụng primer có gắn 3 nu chọn lọc ở đầu 3’ và chỉ EcoRI primer được đánh dấu huỳnh quang ở đầu 5’. Vì vậy, chỉ những sợi chứa EcoRI được phát hiện trên máy ABI 310. PCR được xảy ra với thông số miêu tả bởi Cervera và ctv (1996).  Phản ứng bắt đầu với nhiệt độ cao gắn mồi  tối hảo cho mồi chọn lọc.  Nhiệt độ này giảm dần sẽ làm tăng sự kết hợp. Sử dụng primer gắn với 3 nu chọn lọc sẽ giúp hạn chế việc bắt cặp sai (mismatch), chỉ nhân lên một số lượng lớn những băng chuyên biệt.

Ngoài ra, việc khuếch đại qua 2 bước có những thuận lợi hơn khuếch đại trực tiếp như:

- Phổ diện rõ hơn vì không có quá nhiều loại marker.

- Qua bước tiền khuếch đại, tạo lượng lớn DNA khuôn cho sự khuếch đại dễ dàng và hiệu quả hơn.

- Sau khi xong phản ứng, mẫu được biến tính bằng cách thêm một lượng tương đương thể tích 15µl dung dịch đệm Formamide và đun nóng 5’ ở 95oC.  1ml mỗi mẫu được nạp tự động vào ống mao quản (capilary) polymer ABI 310.

 

 

 

                 Hình : các bước thực hiện kỹ thuật AFLP

 

 

2. Ưu và nhược điểm của kỹ thuật AFLP

Ưu điểm của kỹ thuật AFLP

- AFLP không phức tạp như RFLP nhưng vẫn khảo sát được toàn bộ gen.

- Có tính lặp lại cao hơn RAPD và chỉ cần sử dụng một lượng nhỏ DNA ban đầu (2.5pg-25ng)

- Khuếch đại có chọn lọc một lượng lớn các đoạn DNA đa hình (polymorphism) trong một phản ứng PCR, phù hợp cho việc phân tích đa dạng giữa các quần thể có quan hệ gần nhau.

- Không cần biết trước trình tự DNA của gen cần nghiên cứu, không cần sử dụng nhiều loại primer.

- Là kỹ thuật in dấu DNA còn khá mới lạ nhưng rất hiệu quả, có thể in dấu DNA của  bất kỳ nguồn gốc phức tạp nào từ sinh vật sơ hạch, thực vật, động vật đến con người.

Nhược điểm

- Tuy nhiên AFLP là một marker trội, điều này làm hạn chế phân biệt cá thể đồng hợp và dị hợp.

- Qui trình dài, phức tạp, tốn nhiều thời gian thực hiện.

- Lệ thuộc nhiều vào thao tác ở những bước đầu để có được phổ diện các phân đoạn DNA lý tưởng.

 

III. Ứng dụng

- In dấu DNA, lập bản đồ DNA marker có hiệu quả nhất so với những marker khác (Vos và ctv., 1995). 

- Tạo nhóm liên kết di truyền giữa các giống.

- Đánh giá mức độ liên hệ di truyền hoặc sự khác nhau giữa các giống.

- Là công cụ hiệu quả để phát hiện tính chất đa hình nên dễ dàng nhận biết sự khác biệt giữa các cá thể.

 

  • Travis và cộng sự đã ứng dụng kỹ thuật AFLP để đánh gía sự đa dạng di truyền giữa tất cả những quần thể của Astragalus cremnophylax . Chín loại mồi đã được sử dụng để cho ra 325 vạch của 143 cá thể được thu mẫu từ ba quần thể. Từ kết quả phân tích được, Travis và cộng tác viên (1996) có thể biểu thị đặc điểm của sự đa dạng di truyền và cấu trúc quần thể của chúng và đưa ra hướng quản lý việc bảo tồn loài cây này.

(Travis, S. E., J. Maschinski and P. Keim, 1996. An analysis of genetic variation in  Astragalus cremnophylax a  critically – endangered plant, using AFLP marker. Molecular Ecology 5:735-745)

  • Van Droogenbroek B. et al., 2002. kỹ thuật này được ứng dụng để nghiên cứu mối quan hệ di truyền giữa các giống đu đủ trồng và đu đủ hoang dại (Caricaceae) ở Ecuador

(Van Droogenbroek B., Breyne P., Goetghebeur  P.,  Romeijin Peter E., Kyndt T., Gheysen G., 2002. AFLP analysis of genetic relationships among papaya and its wild relative (Caricaceae) from Ecuador. Theor Appl Genet 105: 289-297)

  • Nguyễn Thị Loan Anh và cộng sự đã sử dụng kỹ thuật AFLP  để nghiên cứu đa dạng sinh học các giống bưởi (Citrus maxima (Burm.) Merr.) ở Việt Nam. Kết quả tổng số có 60 dấu phân tử ghi nhận được, trong đó có 6 dấu phân tử xuất hiện ở tất cả các giống bưởi nghiên cứu, 2 dấu phân tử xuất hiện với tần suất 1/40 giống.

(Nguyễn Thị Loan Anh, Đỗ Tấn Khang, Trần Nhân Dũng, Hà Thanh Toàn, Tina Kyndt, Godelieve Gheysen, Marcelle Holsters, 2008. Nghiên cứu đa dạng sinh học các giống bưởi (Citrus maxima (Burm.) Merr.)  ở Việt Nam. Hội nghị khoa học cây ăn trái quan trọng ở Đồng Bằng Sông Cửu Long. NXB Nông Nghiệp TPHCM).

 

 

 

 

About these ads

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s